Effect of 4 weeks of resistance training on Neural cell adhesion molecule gene expression of neuromuscular junction, gastrocnemius muscle in male rats
Subject Areas : Sport Physiology
Mozhgan Hassan zadeh
1
(Department of exercise physiology, Central Tehran Branch, Islamic Azad University, Tehran, Iran.)
Mohammad Ali Azarbayjani
2
( Department of Sport Physiology, Central Tehran Branch, Islamic Azad University, Tehran, Iran )
Shahin Riyahi Malayeri
3
(Department of Physical Education and Sport Sciences, East Tehran Branch, Islamic Azad University, Tehran, Iran.)
Maghsoud Peeri
4
(Department of exercise physiology, Central Tehran Branch, Islamic Azad University, Tehran, Iran.)
Hassan Matin Homaee
5
(Department of exercise physiology, Central Tehran Branch, Islamic Azad University, Tehran, Iran.)
Keywords: resistance training, Neural cell adhesion, molecule gene,
Abstract :
Background: Resistance training improves skeletal muscle function by affecting the proteins of the nervous system. However, there are conflicting results regarding the effects of resistance training on Neural cell adhesion molecule (NCAM) gene expression. Therefore, the present study aimed to investigate the effect of 4 weeks of increasing resistance training on NCAM gene expression in the gastrocnemius muscle of healthy male rats. Materials and Methods: In an experimental trial, 12 young male rats were randomly divided into 2 groups of 6, including the control and resistance training groups. The training group performed increasing resistance training 5 days a week for 4 weeks on a special rodent ladder. Forty-eight hours after the end of the training intervention, the rats were sacrificed and the gastrocnemius muscle tissue was extracted for the expression of the NCAM gene using the real-time method. Results: resistance training in the neuromuscular junction, gastrocnemius muscle increased NCAM gene expression (P=0.036) compared to the control group. Conclusion: Four weeks of resistance training can improve skeletal muscle function by increasing NCAM gene expression at the end of muscle fibers.
1. Luciano TF, Marques SO, Pieri BL, de Souza DR, Araújo LV, Nesi RT, Scheffer DL, Comin VH, Pinho RA, Muller AP, de Souza CT. Responses of skeletal muscle hypertrophy in Wistar rats to different resistance exercise models. Physiol Res. 2017 May 4;66(2):317-323. doi: 10.33549/physiolres.933256. Epub 2016 Dec 16. PMID: 27982685.
2. Arabzadeh E, Shirvani H, Ebadi Zahmatkesh M, Riyahi Malayeri S, Meftahi GH, Rostamkhani F. Irisin/FNDC5 influences myogenic markers on skeletal muscle following high and moderate-intensity exercise training in STZ-diabetic rats. 3 Biotech. 2022 Sep;12(9):193. doi: 10.1007/s13205-022-03253-9. Epub 2022 Jul 26. PMID: 35910290; PMCID: PMC9325938.
3. Daneshvar N, Anderson JE. Preliminary Study of S100B and Sema3A Expression Patterns in Regenerating Muscle Implicates P75-Expressing Terminal Schwann Cells and Muscle Satellite Cells in Neuromuscular Junction Restoration. Frontiers in Cell and Developmental Biology. 2022 Jul 18; 10:874756. https://doi.org/10.3389/fcell.2022.874756
4. Stanga S, Boido M, Kienlen-Campard P. How to Build and to Protect the Neuromuscular Junction: The Role of the Glial Cell Line-Derived Neurotrophic Factor. Int J Mol Sci. 2020 Dec 24;22(1):136. doi: 10.3390/ijms22010136. PMID: 33374485; PMCID: PMC7794999.
5. Gharibani P, Abramson E, Shanmukha S, Smith MD, Godfrey WH, Lee JJ, Hu J, Baydyuk M, Dorion MF, Deng X, Guo Y, Hwang S, Huang JK, Calabresi PA, Kornberg MD, Kim PM. PKC modulator bryostatin-1 therapeutically targets CNS innate immunity to attenuate neuroinflammation and promote remyelination. bioRxiv [Preprint]. 2023 Aug 29:2023.08.28.555084. doi: 10.1101/2023.08.28.555084. PMID: 37693473; PMCID: PMC10491095.
6. Hosseini M, Ghasem Zadeh Khorasani N, Divkan B, Riyahi Malayeri S. Interactive Effect of High Intensity Interval Training with Vitamin E Consumption on the Serum Levels of Hsp70 and SOD in Male Wistar Rats. Iranian J Nutr Sci Food Technol 2019; 13 (4) :21-28. URL: http://nsft.sbmu.ac.ir/article-1-2689-en.html
7. Cunningham KL, Littleton JT. Mechanisms controlling the trafficking, localization, and abundance of presynaptic Ca2+ channels. Front Mol Neurosci. 2023 Jan 13; 15:1116729. doi: 10.3389/fnmol.2022.1116729. PMID: 36710932; PMCID: PMC9880069.
8. Iqbal Z, Azmi S, Yadav R, Ferdousi M, Kumar M, Cuthbertson DJ, Lim J, Malik RA, Alam U. Diabetic Peripheral Neuropathy: Epidemiology, Diagnosis, and Pharmacotherapy. Clin Ther. 2018 Jun;40(6):828-849. doi: 10.1016/j.clinthera.2018.04.001. Epub 2018 Apr 30. PMID: 29709457.
9. Wei JH, Chang NC, Chen SP, Geraldine P, Jayakumar T, Fong TH. Comparative decline of the protein profiles of nebulin in response to denervation in skeletal muscle. Biochem Biophys Res Commun. 2015 Oct 9;466(1):95-102. doi: 10.1016/j.bbrc.2015.08.114. Epub 2015 Aug 29. PMID: 26325472.
10. Xu W, Zhang J, Wang Y, Wang L, Wang X. Changes in the expression of voltage-gated sodium channels Nav1.3, Nav1.7, Nav1.8, and Nav1.9 in rat trigeminal ganglia following chronic constriction injury. Neuroreport. 2016 Aug 17;27(12):929-34. doi: 10.1097/WNR.0000000000000632. PMID: 27327156.
11. Caldow MK, Thomas EE, Dale MJ, Tomkinson GR, Buckley JD, Cameron-Smith D. Early myogenic responses to acute exercise before and after resistance training in young men. Physiol Rep. 2015 Sep;3(9):e12511. doi: 10.14814/phy2.12511. PMID: 26359239; PMCID: PMC4600377.
12. Tayebi SM, Siahkouhian M, Keshavarz M, Yousefi M. The effects of high-intensity interval training on skeletal muscle morphological changes and denervation gene expression of aged rats. Montenegrin Journal of Sports Science and Medicine. 2019 Sep 1;8(2):39-45. doi: 10.26773/mjssm.190906.
13. Raper J, Mason C. Cellular strategies of axonal pathfinding. Cold Spring Harb Perspect Biol. 2010 Sep;2(9):a001933. doi: 10.1101/cshperspect.a001933. Epub 2010 Jun 30. PMID: 20591992; PMCID: PMC2926747.
14. Deschenes MR, Sherman EG, Roby MA, Glass EK, Harris MB. Effect of resistance training on neuromuscular junctions of young and aged muscles featuring different recruitment patterns. J Neurosci Res. 2015 Mar;93(3):504-13. doi: 10.1002/jnr.23495. Epub 2014 Oct 7. PMID: 25287122; PMCID: PMC4293279.
15. Kido K, Eskesen NO, Henriksen NS, Onslev J, Kristensen JM, Larsen MR, Hingst JR, Knudsen JR, Birk JB, Andersen NR, Jensen TE, Pehmøller C, Wojtaszewski JFP, Kjøbsted R. AMPKγ3 Controls Muscle Glucose Uptake in Recovery From Exercise to Recapture Energy Stores. Diabetes. 2023 Oct 1;72(10):1397-1408. doi: 10.2337/db23-0358. PMID: 37506328; PMCID: PMC10545559.
16. Smith MB, Mulligan N. Peripheral neuropathies and exercise. Topics in Geriatric Rehabilitation. 2014 Apr 1;30(2):131-47. doi: 10.1097/TGR.0000000000000013.
17. Burke SK, Fenton AI, Konokhova Y, Hepple RT. Variation in muscle and neuromuscular junction morphology between atrophy-resistant and atrophy-prone muscles supports failed re-innervation in aging muscle atrophy. Exp Gerontol. 2021 Dec; 156:111613. doi: 10.1016/j.exger.2021.111613. Epub 2021 Nov 3. PMID: 34740815.
18. Gueldich H, Zarrouk N, Chtourou H, Zghal F, Sahli S, Rebai H. Electrostimulation Training Effects on diurnal Fluctuations of Neuromuscular Performance. Int J Sports Med. 2017 Jan;38(1):41-47. doi: 10.1055/s-0042-115033. Epub 2016 Oct 28. PMID: 27793063.
19. Huygaerts S, Cos F, Cohen DD, Calleja-González J, Guitart M, Blazevich AJ, Alcaraz PE. Mechanisms of Hamstring Strain Injury: Interactions between Fatigue, Muscle Activation and Function. Sports (Basel). 2020 May 18;8(5):65. doi: 10.3390/sports8050065. PMID: 32443515; PMCID: PMC7281534.
20. Ferrara PJ, Rong X, Maschek JA, Verkerke AR, Siripoksup P, Song H, Green TD, Krishnan KC, Johnson JM, Turk J, Houmard JA, Lusis AJ, Drummond MJ, McClung JM, Cox JE, Shaikh SR, Tontonoz P, Holland WL, Funai K. Lysophospholipid acylation modulates plasma membrane lipid organization and insulin sensitivity in skeletal muscle. J Clin Invest. 2021 Apr 15;131(8): e135963. doi: 10.1172/JCI135963. PMID: 33591957; PMCID: PMC8262507.
21. Roberts LA, Raastad T, Markworth JF, Figueiredo VC, Egner IM, Shield A, Cameron-Smith D, Coombes JS, Peake JM. Post-exercise cold water immersion attenuates acute anabolic signalling and long-term adaptations in muscle to strength training. J Physiol. 2015 Sep 15;593(18):4285-301. doi: 10.1113/JP270570. Epub 2015 Aug 13. PMID: 26174323; PMCID: PMC4594298.
22. Gil JH, Kim CK. Effects of different doses of leucine ingestion following eight weeks of resistance exercise on protein synthesis and hypertrophy of skeletal muscle in rats. J Exerc Nutrition Biochem. 2015 Mar;19(1):31-8. doi: 10.5717/jenb.2015.19.1.31. Epub 2015 Mar 31. PMID: 25960953; PMCID: PMC4424444.
23. Maffiuletti NA, Zory R, Miotti D, Pellegrino MA, Jubeau M, Bottinelli R. Neuromuscular adaptations to electrostimulation resistance training. Am J Phys Med Rehabil. 2006 Feb;85(2):167-75. doi: 10.1097/01.phm.0000197570.03343.18. PMID: 16428910.
24. Gharakhanlou R, Chadan S, Gardiner P. Increased activity in the form of endurance training increases calcitonin gene-related peptide content in lumbar motoneuron cell bodies and in sciatic nerve in the rat. Neuroscience. 1999;89(4):1229-39. doi: 10.1016/s0306-4522(98)00406-0. PMID: 10362310.
25. Deschenes MR, Tenny KA, Wilson MH. Increased and decreased activity elicits specific morphological adaptations of the neuromuscular junction. Neuroscience. 2006;137(4):1277-83. doi: 10.1016/j.neuroscience.2005.10.042. Epub 2005 Dec 15. PMID: 16359818.
26. Azarbaijani MA, Nikbakht H, Rasae MJ. Sabeti Kh Effect of exhaustive incremental exercise session on salivary testosterone and cortisol in wrestlers. The Journal of Applied Sport Science Research. 2002;4:101-4. URL: https://www.sid.ir/paper/68216/en
27. Wilson MH, Deschenes MR. The neuromuscular junction: anatomical features and adaptations to various forms of increased, or decreased neuromuscular activity. Int J Neurosci. 2005 Jun;115(6):803-28. doi: 10.1080/00207450590882172. PMID: 16019575.
28. Riyahi Malayeri, S., Mirakhorli, M. The Effect of 8 Weeks of Moderate Intensity Interval Training on Omentin Levels and Insulin Resistance Index in Obese Adolescent Girls. Sport Physiology & Management Investigations, 2018; 10(2): 59-68. https://www.sportrc.ir/article_67070.html?lang=en.
29. Su YH, Su Z, Zhang K, Yuan QK, Liu Q, Lv S, Wang ZH, Zou W. [The changes of p-Akt/MuRF1/FoxO1 proteins expressions in the conditions of training and immobilization in rats' gastrocnemius muscle]. Sheng Li Xue Bao. 2014 Oct 25;66(5):589-96. Chinese. PMID: 25332005.
Effect of 4 weeks of resistance training on Neural cell adhesion molecule gene expression of neuromuscular junction, gastrocnemius muscle in male rats
|
Journal of Exercise&
|
Research Article |
Mozhgan Hassan zadeh1, Mohammad Ali Azarbayjani *1, Shahin Riyahi Malayeri2, Maghsoud Peeri 1, Matin Homaee Hassan1 1. Department of exercise physiology, Central Tehran Branch, Islamic Azad University, Tehran, Iran. 2. Department of sport sciences, East Tehran Branch, Islamic Azad University, Tehran, Iran. |
Abstract
Background: Resistance training improves skeletal muscle function by affecting the proteins of the nervous system. However, there are conflicting results regarding the effects of resistance training on Neural cell adhesion molecule (NCAM) gene expression. Therefore, the present study aimed to investigate the effect of 4 weeks of increasing resistance training on NCAM gene expression in the gastrocnemius muscle of healthy male rats. Materials and Methods: In an experimental trial, 12 young male rats were randomly divided into 2 groups of 6, including the control and resistance training groups. The training group performed increasing resistance training 5 days a week for 4 weeks on a special rodent ladder. Forty-eight hours after the end of the training intervention, the rats were sacrificed and the gastrocnemius muscle tissue was extracted for the expression of the NCAM gene using the real-time method. Results: resistance training in the neuromuscular junction, gastrocnemius muscle increased NCAM gene expression (P=0.036) compared to the control group. Conclusion: Four weeks of resistance training can improve skeletal muscle function by increasing NCAM gene expression at the end of muscle fibers. |
Received: 14 December 2023 Revised: 20 January 2024 Accepted: 1 March 2024
Keywords: Resistance training, Neural cell adhesion molecule gene |
Received 3 March 2021; Accepted 5 May 2021 |
Journal of Sports Physiology and Athletic Conditioning Talk |
*Corresponding author: Mohammad Ali Azarbayjani Address: Department of exercise physiology, Central Tehran Branch, Islamic Azad University, Tehran, Iran. Email: ali.azarbayjani@gmail.com Tell: 00982122481622-3 M H: 0000-0002-3502-7487
|
1. Introduction |
Journal of Exercise&
|
Also, resistance training can increase the production and release of Ca++ from the cytosol of the cell, and due to the activation of protein kinase alpha, beta, and gamma isoforms, as well as calcium-dependent kinase such as calmodulin, it can directly increase protein synthesis in skeletal muscle. develops (15). Therefore, due to the use of fast-twitch fibers along with strength training, it seems that doing this type of training is effective for maintaining the neuromuscular structure and function in preventing related diseases (16). A comparison of the effect of the type of exercise in preventing atrophy showed that resistance exercise is more effective than endurance exercise on pre- and post-synaptic components in expanding nerve-to-muscle connection (17). Resistance training increases muscle tension due to the faster release of Na+, and Ca++ ions, the release of acetylcholine from nerve terminals, and creates neuromuscular relaxation (18). On the other hand, during resistance training, contracting muscles are subjected to mechanical overload, which stimulates the production of myosin heavy chain, and increases the number of vesicles, improves the speed of nerve message transmission at the end of the muscle fiber (19). Also, the increased cell metabolism during resistance training with increasing intensity, through the activation of the insulin signaling pathway and insulin-like factor-1, smooths the process of protein synthesis, followed by hypertrophy (15). Also, resting between sets of resistance training after motor nerve stimulation is another stimulus in the path of hypertrophy in axon sprouting and its transfer from the extracellular matrix (20). For this reason, resistance training leads to the development of skeletal muscle hypertrophy by calling motor nerve units directly (21) and indirectly by using cellular metabolism (15). |
Skeletal muscle is very important due to the presence of fast and slow contraction fibers in the process of force generation and regulation of transcription in the translation of expression of genes related to motor nerve function (1). At the end of the skeletal muscles, important genes cause the transmission of nerve messages to the depth of the muscle tissue (2) and control the function of the muscle due to Bertolide's effect and force transmission to the tendon (3). Muscle response at different levels of force production is directly related to the principle of muscle fiber recruitment and the volume of muscle use (4). Improper changes in the transcription process and mutation of genes related to the decrease in muscle activity cause a decrease in strength and subsequent weakening of strength (5). Inactivity and lack of regular physical activity increase the density of non-contractile tissues (6). Often, due to the decrease in acetylcholine production and disturbance in calcium release, the process of exocytosis is disturbed and together with the synthesis of inhibitory proteins at the end of the motor nerve, force production also decreases (7). However, during the muscle activity along with the contracting process, the expression of a special type of nerve adhesion molecule (NCAM), which is from the family of immunoglobulins, inhibits the atrophy process (11). Also, the expression of this type of protein improves axonal function and develops the hypertrophy process (12). The first step in creating hypertrophy in skeletal muscle cells is the growth and repair of neurons, which is related to the expression of growth factors and nerve conduction (13). According to the conducted studies, resistance training causes the activation of nerve units at the end of the stimulator plate of the muscle tissue and improves strength (14). |
It has been reported that resistance training with appropriate volume increased neural activity (4). Based on this, considering the beneficial effect of resistance training on improving muscle strength, and the existence of contradictions in the findings of previous studies, the present study aimed to investigate the effect of 4 weeks of increasing resistance training on NCAM gene expression in the neuromuscular junction of the gastrocnemius muscle of healthy male rats. |
Before the implementation of the increasing resistance training protocol, the maximum of one repetition (1RM) of the subjects was performed by adding weights to the tail with Lecoplast adhesive (the sensitivity of the mice's tail to this type of adhesive was checked before the exercise). In the first session, the training started by adding a weight equal to 50% of the body weight to their tail, then 30 grams of weight was added to the sets and continued until the subjects were unable to lift the weight, according to this, the last weight that the subjects carried was considered as a maximum of one maximum repetition (22). The resistance training program was carried out for 4 weeks and 5 days a week, and the sixth day of each week was considered to measure the maximum of one repetition of gradual weight gain for the following week. Before the exercise, they first performed the warm-up program in 3 repetitions without carrying weights, then resistance exercise was performed in the first week with 50% of the subjects' body weight, and for the next sessions, the exercise was started with 50% of the last weight carried. In this way, the training load included 50% in the first week, 75% in the second week, 90% in the third week, and 100% in the fourth week of the maximum weight that they managed to carry on the ladder. The number of repetitions in each session was 2 repetitions and in 3 sets with a rest time of 1 minute between each repetition and 2 minutes between each set (22). During this period, for equalization, the control group was placed on the ladder 5 times a week for 10 to 15 minutes in each session. The details of the resistance training program are presented in Table 1. |
2. Materials and Methods |
In an experimental trial, 12 male Wistar rats weighing between 185 and 220 were purchased from the Institute Pasteur in Iran and transferred to the animal laboratory. After a week of familiarization with the laboratory environment, the subjects were randomly divided into two resistance training groups and the control group. The subjects were kept in transparent polycarbonate cages made by the Razi Rad Company in an environment with a temperature of 22±2 degrees Celsius and a light-dark cycle of 12:12 and free access to water and food for animals (pellets). All stages of the study were carried out in compliance with the principles of working with laboratory animals approved by the Ministry of Health and Medical Education of the Islamic Republic of Iran. Resistance training program To implement the increasing resistance training program, after a week of familiarizing the subjects with the resistance training program (ladder with a height of 110 cm, the distance between each step is 2 cm and the slope of the ladder is 80 percent) without carrying weights with the help of the trainer, 3 to 5 high repetitions They went up the stairs. |
Table 1. training protocol
|
Resistance training | ||||
Week | 1 | 2 | 3 | 4 |
Amount of weight per session (1RM) | 50% | 75% | 90% | 100% |
The number of sets per session | 3 | 3 | 3 | 3 |
Number of repetitions per set per session | 2 | 2 | 2 | 2 |
Rest time between sets(min) | 2 | 2 | 2 | 2 |
Rest time between each repetition (min) | 1 | 1 | 1 | 1 |
For each of the samples, 2 micrograms of mRNA were used to synthesize the first strand of cDNA. The relative amount of gene expression of the studied genes in the twin muscle was measured with the help of their specific primers, and the absorbance ratio of 260 to 280 nanograms was 1 to 2.8 for all extracted samples. Checking the quality of RNA extracted by electrophoresis and 1% agarose gel was used. It should be noted that DNAs treatment (thermos scientific, made in Germany) was done to ensure the absence of DNA in the extracted sample before cDNA assay. cDNA synthesis was done using transe criptor first strand cDNAsynthesis kit (Roch, Germany) according to the instructions of the kits. A real-time PCR program was performed with a Rotrogene 6000, Corbet, made in Germany. The program according to Syber Green (ampligon, made in Denmark) with a cycle of 95°C for 15 minutes and immediately 40 cycles with 95°C for 15 seconds and 60°C for 60 seconds with design primer (Made by Nika Biogene Iran) was done. Gene expression quantification was calculated with the formula ∆∆ ct-2 and Fold Change values. The primers used are presented in Table 2. |
Tissue sampling And RNA extraction and quantitative real-time PCR In the fourth week, 24 hours after the last training session and recovery after that, the rats were anesthetized by intraperitoneal injection of ketamine (90 mg/kg) and xylazine (10 mg/kg). Then the blood sample was collected directly from the left ventricle of the heart of the mice to cause the death of the subjects. Then, the tissue of the gastrocnemius muscle was immediately extracted by cutting the lower limb frozen in -20 nitrogen and stored in a -80 freezer for gene expression measurement. To measure NCAM gene expression, the real-time method with Premix Extaqit was used and GAPDH was used as a control gene, and the expression value of this gene was measured in tandem with each of the genes with a 50 Mir nasy mini kit (manufactured by Qiagen). Germany), performed according to the instructions. For RNA extraction, 50 mg of frozen rat gastrocnemius muscle tissue was homogenized and according to the instructions of the manufacturer of the kit, the RNA solution was extracted from it and cleaned from any DNA contamination and RNA degrading enzymes by DNaseI enzyme. |
Table 2. Primers used |
Gene name | Forward | Reverse |
NCAM | CTACTGGACATTTCCTTGGTC | GGCTCCTGCTTCGTAGTCC |
GAPDH | AAGTTCAACGGCACAGTCAAGG | CATACTCAGCACCAGCATCACC |
NCAM: Neural cell adhesion molecule: GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase.
3. Results |
Statistical model Data obtained from genetic assays are reported based on mean and standard deviation. The normality of data distribution was determined by the Shapiro-Wilk test. Determining the difference between resistance training and control groups was analyzed using a t-test for independent groups. A significance level of ≥5% was considered. All calculations were performed using the software GraphPad prism version 8. |
NCAM gene expression in neuromuscular junction, gastrocnemius muscle increased significantly after resistance training compared to the control group (P=0.036) Figure 1 |
Figure 1: The ratio of NCAM gene expression to GAPDH in the increasing resistance training group and the control group. *Significant difference compared to the control group (P=0.05). Data are reported based on mean and standard deviation. |
The improvement in muscle strength induced by resistance training may be partly explained by the reinnervation of skeletal muscle fibers and upregulation of NCAM (B). An increase in MHC II fiber size after resistance training has been reported to be associated with increased NCAM gene expression (C). MHC II fibers have been reported to be at risk of inactivity-related atrophy, and resistance training preferentially increases MHC II fiber function and size. Increased NCAM expression in MHC II fibers is more prominently associated with resistance training-induced improvements in fiber strength and size. Based on this, it is clear that improvement in fiber diameter and total muscle strength after resistance training may be achieved through neural adaptations/muscle fiber reinnervation. Evidence shows that the decrease in NCAM expression in experimental autoimmune encephalomyelitis mice may be attributed to increased inflammation and oxidative stress in the neuromuscular junction as well as axonal damage. On the contrary, in mice with experimental autoimmune encephalomyelitis, NCAM expression was increased by exercise, which seems to be due to the reduction of inflammation and oxidative stress caused by exercise (D). Based on this, it seems that the resistance exercise used in the present study may have increased the expression of NCAM in the neuromuscular junction by inhibiting inflammation and oxidative stress. NCAM plays an important role in signal transmission, synaptogenesis, synaptic plasticity, promotes and regulates synaptic stability, and strongly affects neurotransmission (E). According to the roles of NCAM, its increase after resistance training is one of the mechanisms for improving the performance of the squat muscle due to neurological changes. It has been reported that intense intermittent exercise prevented muscle atrophy by increasing |
4. Discussion |
In the present study, the effect of 4 weeks of increasing resistance training on NCAM gene expression in the gastrocnemius muscle of male rats was investigated. The results showed that NCAM gene expression increased significantly in the training group. Resistance training by influencing the process of sodium and potassium channels in the muscle fiber increases the speed of nerve message transmission and by releasing more acetylcholine from motor nerve terminals, it creates a greater neuro-muscular response and creates a stronger contraction in the muscle. represent (23,24). On the other hand, during repeated contractions, with mechanical overload, blood flow restriction subsequent lactic hypoxemia, and increased adenosine, the production and release of acetylcholine in the presynaptic environment expand (25). The fast-twitch fibers in skeletal muscles have androgenic receptors, which in response to strength training, prevent the destruction of the muscle structure by activating protein synthesis signaling pathways (26). During the recovery after exercise, the increase in nitric oxide causes more blood supply to the muscle and activating neurotrophins regulate the synthesis of acetylcholinesterase and develop the function of the neuromuscular junction (27). It has been reported that combined training (strength-endurance) causes an increase in the number of acetylcholine receptors in fast and slow twitch fibers compared to strength and resistance training, as well as the content of acetylcholine in the motor nerve, which increases the contraction performance (28,29). NCAM is a member of the family of immunoglobulins and is expressed in nerve cells and glial cells, which is closely related to axonal growth, remyelination processes, guidance, and fasciculation, and participates in repair mechanisms (A). |
Investigation Sh.R.M, M.P, M.H.H; Resources: M.H, M.A.A, M.H.H; Data curation: M.H, M.A.A, Sh.R.M,; Writing - original draft: M.H, M.P, M.H.H; Writing - review & editing: M.H, M.A.A, Sh.R.M, M.P; Visualization: M.A.A, Sh.R.M, M.P, M.H.H; Supervision: M.H, M.A.A, M.H.H; Project administration: M.H, M.A.A, Sh.R.M, M.P, M.H.H; Funding acquisition: M.H, M.A.A, Sh.R.M, M.P, M.H.H.
|
NCAM in old rats (12). According to the results of the present study regarding the effect of resistance training on the increase of NCAM in the gastrocnemius muscle of healthy mice, this type of training is probably effective in expanding the presynaptic space. |
Conclusion
|
The results of the present study showed that resistance training increased NCAM gene expression in the gastrocnemius muscle. Since NCAM gene expression is associated with increased synaptic stability and improved nerve transmission, it can be concluded that resistance training by influencing the expression of this gene improves the process of transmitting nerve messages to skeletal muscle and thereby improves muscle function. |
References |
1. Luciano TF, Marques SO, Pieri BL, de Souza DR, Araújo LV, Nesi RT, Scheffer DL, Comin VH, Pinho RA, Muller AP, de Souza CT. Responses of skeletal muscle hypertrophy in Wistar rats to different resistance exercise models. Physiol Res. 2017 May 4;66(2):317-323. doi: 10.33549/physiolres.933256. Epub 2016 Dec 16. PMID: 27982685. 2. Arabzadeh E, Shirvani H, Ebadi Zahmatkesh M, Riyahi Malayeri S, Meftahi GH, Rostamkhani F. Irisin/FNDC5 influences myogenic markers on skeletal muscle following high and moderate-intensity exercise training in STZ-diabetic rats. 3 Biotech. 2022 Sep;12(9):193. doi: 10.1007/s13205-022-03253-9. Epub 2022 Jul 26. PMID: 35910290; PMCID: PMC9325938. 3. Daneshvar N, Anderson JE. Preliminary Study of S100B and Sema3A Expression Patterns in Regenerating Muscle Implicates P75-Expressing Terminal Schwann Cells and Muscle Satellite Cells in Neuromuscular Junction Restoration. Frontiers in Cell and Developmental Biology. 2022 Jul 18; 10:874756. https://doi.org/10.3389/fcell.2022.874756 4. Stanga S, Boido M, Kienlen-Campard P. How to Build and to Protect the Neuromuscular Junction: The Role of the Glial Cell Line-Derived Neurotrophic Factor. Int J Mol Sci. 2020 Dec 24;22(1):136. doi: 10.3390/ijms22010136. PMID: 33374485; PMCID: PMC7794999. 5. Gharibani P, Abramson E, Shanmukha S, Smith MD, Godfrey WH, Lee JJ, Hu J, Baydyuk M, Dorion MF, Deng X, Guo Y, Hwang S, Huang JK, Calabresi PA, Kornberg MD, Kim PM. PKC modulator bryostatin-1 therapeutically targets CNS innate immunity to attenuate neuroinflammation and promote remyelination. bioRxiv [Preprint]. 2023 Aug 29:2023.08.28.555084. doi: 10.1101/2023.08.28.555084. PMID: 37693473; PMCID: PMC10491095.
|
Acknowledgements |
The researchers hereby express their gratitude and thanks to the research subjects. |
Funding This study did not have any funds. |
Conceptualization: M.H, M.A.A, Sh.R.M, M.P, M.H.H; Methodology: M.A.A, Sh.R.M, M.P, M.H.H; Software: M.H, M.A.A, Sh.R.M, M.P; Validation: M.H, Sh.R.M, M.P, M.H.H; Formal analysis: M.H, M.A.A, M.P, M.H.H; |
Author contributions
|
Conflict of interest None declared. Ethical approval the research was conducted with regard to the ethical principles. Informed consent Informed consent was obtained from all participants.
|
Compliance with ethical standards |
14. Deschenes MR, Sherman EG, Roby MA, Glass EK, Harris MB. Effect of resistance training on neuromuscular junctions of young and aged muscles featuring different recruitment patterns. J Neurosci Res. 2015 Mar;93(3):504-13. doi: 10.1002/jnr.23495. Epub 2014 Oct 7. PMID: 25287122; PMCID: PMC4293279. 15. Kido K, Eskesen NO, Henriksen NS, Onslev J, Kristensen JM, Larsen MR, Hingst JR, Knudsen JR, Birk JB, Andersen NR, Jensen TE, Pehmøller C, Wojtaszewski JFP, Kjøbsted R. AMPKγ3 Controls Muscle Glucose Uptake in Recovery From Exercise to Recapture Energy Stores. Diabetes. 2023 Oct 1;72(10):1397-1408. doi: 10.2337/db23-0358. PMID: 37506328; PMCID: PMC10545559. 16. Smith MB, Mulligan N. Peripheral neuropathies and exercise. Topics in Geriatric Rehabilitation. 2014 Apr 1;30(2):131-47. doi: 10.1097/TGR.0000000000000013. 17. Burke SK, Fenton AI, Konokhova Y, Hepple RT. Variation in muscle and neuromuscular junction morphology between atrophy-resistant and atrophy-prone muscles supports failed re-innervation in aging muscle atrophy. Exp Gerontol. 2021 Dec; 156:111613. doi: 10.1016/j.exger.2021.111613. Epub 2021 Nov 3. PMID: 34740815. 18. Gueldich H, Zarrouk N, Chtourou H, Zghal F, Sahli S, Rebai H. Electrostimulation Training Effects on diurnal Fluctuations of Neuromuscular Performance. Int J Sports Med. 2017 Jan;38(1):41-47. doi: 10.1055/s-0042-115033. Epub 2016 Oct 28. PMID: 27793063. 19. Huygaerts S, Cos F, Cohen DD, Calleja-González J, Guitart M, Blazevich AJ, Alcaraz PE. Mechanisms of Hamstring Strain Injury: Interactions between Fatigue, Muscle Activation and Function. Sports (Basel). 2020 May 18;8(5):65. doi: 10.3390/sports8050065. PMID: 32443515; PMCID: PMC7281534. 20. Ferrara PJ, Rong X, Maschek JA, Verkerke AR, Siripoksup P, Song H, Green TD, Krishnan KC, Johnson JM, Turk J, Houmard JA, Lusis AJ, Drummond MJ, McClung JM, Cox JE, Shaikh SR, Tontonoz P, Holland WL, Funai K. Lysophospholipid acylation modulates plasma membrane lipid organization and insulin sensitivity in skeletal muscle. J Clin Invest. 2021 Apr 15;131(8): e135963. doi: 10.1172/JCI135963. PMID: 33591957; PMCID: PMC8262507. |
6. Hosseini M, Ghasem Zadeh Khorasani N, Divkan B, Riyahi Malayeri S. Interactive Effect of High Intensity Interval Training with Vitamin E Consumption on the Serum Levels of Hsp70 and SOD in Male Wistar Rats. Iranian J Nutr Sci Food Technol 2019; 13 (4) :21-28. URL: http://nsft.sbmu.ac.ir/article-1-2689-en.html 7. Cunningham KL, Littleton JT. Mechanisms controlling the trafficking, localization, and abundance of presynaptic Ca2+ channels. Front Mol Neurosci. 2023 Jan 13; 15:1116729. doi: 10.3389/fnmol.2022.1116729. PMID: 36710932; PMCID: PMC9880069. 8. Iqbal Z, Azmi S, Yadav R, Ferdousi M, Kumar M, Cuthbertson DJ, Lim J, Malik RA, Alam U. Diabetic Peripheral Neuropathy: Epidemiology, Diagnosis, and Pharmacotherapy. Clin Ther. 2018 Jun;40(6):828-849. doi: 10.1016/j.clinthera.2018.04.001. Epub 2018 Apr 30. PMID: 29709457. 9. Wei JH, Chang NC, Chen SP, Geraldine P, Jayakumar T, Fong TH. Comparative decline of the protein profiles of nebulin in response to denervation in skeletal muscle. Biochem Biophys Res Commun. 2015 Oct 9;466(1):95-102. doi: 10.1016/j.bbrc.2015.08.114. Epub 2015 Aug 29. PMID: 26325472. 10. Xu W, Zhang J, Wang Y, Wang L, Wang X. Changes in the expression of voltage-gated sodium channels Nav1.3, Nav1.7, Nav1.8, and Nav1.9 in rat trigeminal ganglia following chronic constriction injury. Neuroreport. 2016 Aug 17;27(12):929-34. doi: 10.1097/WNR.0000000000000632. PMID: 27327156. 11. Caldow MK, Thomas EE, Dale MJ, Tomkinson GR, Buckley JD, Cameron-Smith D. Early myogenic responses to acute exercise before and after resistance training in young men. Physiol Rep. 2015 Sep;3(9):e12511. doi: 10.14814/phy2.12511. PMID: 26359239; PMCID: PMC4600377. 12. Tayebi SM, Siahkouhian M, Keshavarz M, Yousefi M. The effects of high-intensity interval training on skeletal muscle morphological changes and denervation gene expression of aged rats. Montenegrin Journal of Sports Science and Medicine. 2019 Sep 1;8(2):39-45. doi: 10.26773/mjssm.190906. 13. Raper J, Mason C. Cellular strategies of axonal pathfinding. Cold Spring Harb Perspect Biol. 2010 Sep;2(9):a001933. doi: 10.1101/cshperspect.a001933. Epub 2010 Jun 30. PMID: 20591992; PMCID: PMC2926747.
|
21. Roberts LA, Raastad T, Markworth JF, Figueiredo VC, Egner IM, Shield A, Cameron-Smith D, Coombes JS, Peake JM. Post-exercise cold water immersion attenuates acute anabolic signalling and long-term adaptations in muscle to strength training. J Physiol. 2015 Sep 15;593(18):4285-301. doi: 10.1113/JP270570. Epub 2015 Aug 13. PMID: 26174323; PMCID: PMC4594298. 22. Gil JH, Kim CK. Effects of different doses of leucine ingestion following eight weeks of resistance exercise on protein synthesis and hypertrophy of skeletal muscle in rats. J Exerc Nutrition Biochem. 2015 Mar;19(1):31-8. doi: 10.5717/jenb.2015.19.1.31. Epub 2015 Mar 31. PMID: 25960953; PMCID: PMC4424444. 23. Maffiuletti NA, Zory R, Miotti D, Pellegrino MA, Jubeau M, Bottinelli R. Neuromuscular adaptations to electrostimulation resistance training. Am J Phys Med Rehabil. 2006 Feb;85(2):167-75. doi: 10.1097/01.phm.0000197570.03343.18. PMID: 16428910. 24. Gharakhanlou R, Chadan S, Gardiner P. Increased activity in the form of endurance training increases calcitonin gene-related peptide content in lumbar motoneuron cell bodies and in sciatic nerve in the rat. Neuroscience. 1999;89(4):1229-39. doi: 10.1016/s0306-4522(98)00406-0. PMID: 10362310. 25. Deschenes MR, Tenny KA, Wilson MH. Increased and decreased activity elicits specific morphological adaptations of the neuromuscular junction. Neuroscience. 2006;137(4):1277-83. doi: 10.1016/j.neuroscience.2005.10.042. Epub 2005 Dec 15. PMID: 16359818. 26. Azarbaijani MA, Nikbakht H, Rasae MJ. Sabeti Kh Effect of exhaustive incremental exercise session on salivary testosterone and cortisol in wrestlers. The Journal of Applied Sport Science Research. 2002;4:101-4. URL: https://www.sid.ir/paper/68216/en |
27. Wilson MH, Deschenes MR. The neuromuscular junction: anatomical features and adaptations to various forms of increased, or decreased neuromuscular activity. Int J Neurosci. 2005 Jun;115(6):803-28. doi: 10.1080/00207450590882172. PMID: 16019575. 28. Riyahi Malayeri, S., Mirakhorli, M. The Effect of 8 Weeks of Moderate Intensity Interval Training on Omentin Levels and Insulin Resistance Index in Obese Adolescent Girls. Sport Physiology & Management Investigations, 2018; 10(2): 59-68. https://www.sportrc.ir/article_67070.html?lang=en. 29. Su YH, Su Z, Zhang K, Yuan QK, Liu Q, Lv S, Wang ZH, Zou W. [The changes of p-Akt/MuRF1/FoxO1 proteins expressions in the conditions of training and immobilization in rats' gastrocnemius muscle]. Sheng Li Xue Bao. 2014 Oct 25;66(5):589-96. Chinese. PMID: 25332005.
|
